23S rDNA Plastidial Reference database

New First version of µgreen-db: a reference database of the plastidial 23S rRNA gene of photosynthetic eukaryotic algae and cyanobacteria.

News

  1. January 09, 2020: Update : add taxonomy files
  2. December 19, 2018: Migration of website to http://microgreen-23sdatabase.ea.inra.fr

Primers for amplifying and sequencing algae 23S rDNA region

PCR primers
  • p23SrV_f1 and p23SrV_r1 is a pair of 23S rRNA gene fragment targeting the V5 domain (UPA) to characterise algae diversity (Sherwood & Presting, 2007).
Sequencing primers
Primer name Region Sequence (5' --> 3') Target Remarks Reference
p23SrV_f1 UPA GGACAGAAAGACCCTATGAA Bacteria and Eukaryota None Sherwood & Presting, 2007
p23SrV_r1 UPA TCAGCCTGTTATCCCTAGAG Bacteria and Eukaryota None Sherwood & Presting, 2007
References
  1. Sherwood, A. R., & Presting, G. G. (2007). Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria. Journal of Phycology, 43(3), 605–608. doi:10.1111/j.1529-8817.2007.00341.x